caa a22 4500 445860898 CHVBK 20180317145442.0 cr unu---uuuuu 170323e20111001xx s 000 0 eng 10.1007/s00439-011-0977-x doi (NATIONALLICENCE)springer-10.1007/s00439-011-0977-x The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity [Elektronische Daten] [Inna Ovsyannikova, Iana Haralambieva, Robert Vierkant, V. Pankratz, Robert Jacobson, Gregory Poland] Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22years old) after two doses of measles vaccine for TLR signaling SNP markers (n=454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892mIU/ml, p=0.002) and a dose-related decrease (2,209 vs. 830mIU/ml, p=0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p=0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2×105 PBMCs, p=0.00002). We observed an additional 12 associations (p<0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines. Springer-Verlag, 2011 Ovsyannikova Inna Mayo Vaccine Research Group, Mayo Clinic, Guggenheim 611C, 200 1st Street S.W., 55905, Rochester, MN, USA aut Haralambieva Iana Mayo Vaccine Research Group, Mayo Clinic, Guggenheim 611C, 200 1st Street S.W., 55905, Rochester, MN, USA aut Vierkant Robert Department of Health Sciences Research, Mayo Clinic, 55905, Rochester, MN, USA aut Pankratz V. Department of Health Sciences Research, Mayo Clinic, 55905, Rochester, MN, USA aut Jacobson Robert Mayo Vaccine Research Group, Mayo Clinic, Guggenheim 611C, 200 1st Street S.W., 55905, Rochester, MN, USA aut Poland Gregory Mayo Vaccine Research Group, Mayo Clinic, Guggenheim 611C, 200 1st Street S.W., 55905, Rochester, MN, USA aut Human Genetics Springer-Verlag 130/4(2011-10-01), 547-561 0340-6717 130:4<547 2011 130 439 https://doi.org/10.1007/s00439-011-0977-x text/html Onlinezugriff via DOI 1 research-article jats NATIONALLICENCE 856 40 https://doi.org/10.1007/s00439-011-0977-x text/html Onlinezugriff via DOI NATIONALLICENCE 700 1- Ovsyannikova Inna Mayo Vaccine Research Group, Mayo Clinic, Guggenheim 611C, 200 1st Street S.W., 55905, Rochester, MN, USA aut NATIONALLICENCE 700 1- Haralambieva Iana Mayo Vaccine Research Group, Mayo Clinic, Guggenheim 611C, 200 1st Street S.W., 55905, Rochester, MN, USA aut NATIONALLICENCE 700 1- Vierkant Robert Department of Health Sciences Research, Mayo Clinic, 55905, Rochester, MN, USA aut NATIONALLICENCE 700 1- Pankratz V. Department of Health Sciences Research, Mayo Clinic, 55905, Rochester, MN, USA aut NATIONALLICENCE 700 1- Jacobson Robert Mayo Vaccine Research Group, Mayo Clinic, Guggenheim 611C, 200 1st Street S.W., 55905, Rochester, MN, USA aut NATIONALLICENCE 700 1- Poland Gregory Mayo Vaccine Research Group, Mayo Clinic, Guggenheim 611C, 200 1st Street S.W., 55905, Rochester, MN, USA aut NATIONALLICENCE 773 0- Human Genetics Springer-Verlag 130/4(2011-10-01), 547-561 0340-6717 130:4<547 2011 130 439 Metadata rights reserved Springer special CC-BY-NC licence nationallicence BK010053 XK010053 XK010000 NATIONALLICENCE NATIONALLICENCE NL-springer